Immunogenic peptide therapy induces an immune response against a specific antigen, whereas the tolerogenic peptide therapy induces immune tolerance to self-antigens
The dosage is 5%~10%.
Viral infection For lentiviral production, HEK293T cells were co-transfected with 4 g 8.91, 1 g pVSVG, 5 g of lentivector (shRNA targeting SHMT2 : CCAGAATTTGTAGCTGAGATT, and ATF4 : GCGAGTGTAAGGAGCTAGAAA, obtained from RNA Technology platform and Gene manipulating core, Academia Sinica) by using 30 L of Turbofect (Thermo, R0533) in 1 mL of Opti-MEM (Gibco, 31985070) according to the manufacturers instructions
Retrospective database analysis of 65,149 in South Korea, showing significantly lower cases with existing N-acetylcysteine treatment
These results concur with the findings of Zia et al
Discussion Collectively, these results suggested that ACTL6A, which contains a hydrophobic region, cooperates with NRF2 to regulate GCLC expression at the transcriptional level and then promotes GSH synthesis and inhibits the ferroptosis of GC cells
